View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16223_low_11 (Length: 296)
Name: NF16223_low_11
Description: NF16223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16223_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 20 - 286
Target Start/End: Original strand, 1891120 - 1891386
Alignment:
| Q |
20 |
aacttctcgagaattctcaatgtttcacggattttatcctttttcaattgaatatcaccaactgctgctgaattatcttcagtttgtctggcaaaataca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1891120 |
aacttctcgagaattctcaatgtttcacggattttatcctttttcaattgaatatcaccaactgctgctgaattatcttcagtttgtctggcaaaataca |
1891219 |
T |
|
| Q |
120 |
tttggccatcagaatgctttgattcggcatccctgacacattcacacggttcatttagtcttactgaactagcactgtctacgagtggtgataattttgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1891220 |
tttggccatcagaatgctttgattcggcatccctgacacattcacacggttcatttagtcttactgaactagcactgtctacgagtggtgataattttgt |
1891319 |
T |
|
| Q |
220 |
gtacccaccatcaatcaacttgtgccttttgtttggccaatcagagctagcagtatcctcctctgtg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1891320 |
gtacccaccatcaatcaacttgtgccttttgtttggccaatcagagctagcagtatcctcctctgtg |
1891386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University