View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16223_low_16 (Length: 249)
Name: NF16223_low_16
Description: NF16223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16223_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 13 - 233
Target Start/End: Complemental strand, 4961737 - 4961515
Alignment:
| Q |
13 |
aatatgtcggctcagttgatagagtttcacttcctaatttgagggaataaagttcaaatatcacctaaacagacccccttaatgcaactgttactagcaa |
112 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4961737 |
aatatgtcagctcagttgatagagtttcacttcctaatttcaggaaataaagttcaaatatcacctaaacagacccccttaatgcaactgttactagcaa |
4961638 |
T |
 |
| Q |
113 |
aatttccccttcctcaattgaaaaatactatgtatatataagggaacaaccttatatcttgtttaatttatgatgagatttattaatttaatggt---ac |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4961637 |
aatttccccttcctcaattgaaaaatactatgtatatataagggaacaaccttatatcttgtttaatttatgatgagatttattaatttaatggtacgac |
4961538 |
T |
 |
| Q |
210 |
aaactagcttgcaaatgatgtaag |
233 |
Q |
| |
|
|||||||| | ||||||||||||| |
|
|
| T |
4961537 |
aaactagc-tacaaatgatgtaag |
4961515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University