View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16223_low_17 (Length: 236)
Name: NF16223_low_17
Description: NF16223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16223_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 21 - 218
Target Start/End: Original strand, 34957875 - 34958072
Alignment:
| Q |
21 |
ggaggaaaagtttggaatcaaaccaacacaagagcactatgcttgcatgattgatatccttggaaatcagggaaactaaatgaagcggtggaacttatga |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34957875 |
ggaggaaaagtttggaatcaaaccaacacaagagcactatgcttgcatgattgatatccttggaaattagggaaactaaatgaagcggtggaacttatga |
34957974 |
T |
 |
| Q |
121 |
attccattccatttgaagctgatggatccgtttggggggcgcttcttggtgctgcaagaatccacaaaaatgttgaacttggtgaaacagtgcttttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34957975 |
attccattccatttgaagctgatggatccgtttgaggggcgcttcttggtgctgcaagaatccacaaaaatgttgaacttggtgaaacagtgcttttt |
34958072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 21 - 205
Target Start/End: Complemental strand, 50131761 - 50131576
Alignment:
| Q |
21 |
ggaggaaaagtttggaatcaaaccaacacaagagcactatgcttgcatgattgatatccttggaa-atcagggaaactaaatgaagcggtggaacttatg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||| ||| || |
|
|
| T |
50131761 |
ggaggaaaagtttggaatcaaaccaacacaagagcaccatgcttgcatgattgatctccttggaagatcagggaaactaaatgaagcagtggagcttgtg |
50131662 |
T |
 |
| Q |
120 |
aattccattccatttgaagctgatggatccgtttggggggcgcttcttggtgctgcaagaatccacaaaaatgttgaacttggtga |
205 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50131661 |
aattccattccatttgaagccgatggatccgtttggggggcgcttcttggtgctgcaagaatccacaaaaatgttgaacttggtga |
50131576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University