View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16223_low_9 (Length: 320)
Name: NF16223_low_9
Description: NF16223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16223_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 2 - 313
Target Start/End: Complemental strand, 32717316 - 32717005
Alignment:
| Q |
2 |
tagacttcattgacttcatctcatccagtgcagcaaggatatccatctcccttttagaatctagggttttattctctaacgatttcattgcatctccaat |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32717316 |
tagacttcattgacttcatctcatccagtgcagcaaggatatccatctctcttttagaatctagggttttattctctaacgatttcattgcatctccaat |
32717217 |
T |
|
| Q |
102 |
ttcttcggcttccctcttctttttcctttcgtcgctttccttatcctctgcgcgccaaggttcaaaatttctcgttgcaccaaactcaacgacgtaatct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32717216 |
ttcttcggcttccctcttctttttcctttcgtcgctttccttatcctctgcgcgccaaggttcaaaatttctcgttgcaccaaactcaacgacgtaatct |
32717117 |
T |
|
| Q |
202 |
gaattccgcggatcagtcttcatggtatattcagctgagcagcaggtgcatttgccatagaatctgaaaatttgaattccaagatatgtctcgccttcga |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32717116 |
gaattccgcggatcagtcttcatggtatattcagctgagcagcaggtgcatttgccatagaatctgaaaatttgaattccaagatatgtctcgccttcga |
32717017 |
T |
|
| Q |
302 |
caacttcttttc |
313 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32717016 |
caacttcttttc |
32717005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 6 - 292
Target Start/End: Original strand, 29822777 - 29823063
Alignment:
| Q |
6 |
cttcattgacttcatctcatccagtgcagcaaggatatccatctcccttttagaatctagggttttattctctaacgatttcattgcatctccaatttct |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||| |||||| ||||||||||||| |||||||||||||| |||||| |
|
|
| T |
29822777 |
cttcattgacttcatctcatccagtgcagcaaggatgtccatctctcttttggaatccagggttctattctctaacgacttcattgcatctcccatttct |
29822876 |
T |
|
| Q |
106 |
tcggcttccctcttctttttcctttcgtcgctttccttatcctctgcgcgccaaggttcaaaatttctcgttgcaccaaactcaacgacgtaatctgaat |
205 |
Q |
| |
|
|||| |||||||||||||||| |||| ||| |||||| |||||||||||||||||||||||||||||| || |||||| ||||||| || ||||| |||| |
|
|
| T |
29822877 |
tcggtttccctcttctttttcatttcatcggtttcctcatcctctgcgcgccaaggttcaaaatttctggtagcaccagactcaacaacataatccgaat |
29822976 |
T |
|
| Q |
206 |
tccgcggatcagtcttcatggtatattcagctgagcagcaggtgcatttgccatagaatctgaaaatttgaattccaagatatgtct |
292 |
Q |
| |
|
|| |||||||||||||||||||| |||||||||||| | |||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
29822977 |
tctgcggatcagtcttcatggtaagttcagctgagcaccgggtgcatttgaaatagaatctgaaaatttgaattcccagatatgtct |
29823063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 6 - 292
Target Start/End: Complemental strand, 1838957 - 1838671
Alignment:
| Q |
6 |
cttcattgacttcatctcatccagtgcagcaaggatatccatctcccttttagaatctagggttttattctctaacgatttcattgcatctccaatttct |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||| |||||| ||||||||||||| |||||||||||||| |||||| |
|
|
| T |
1838957 |
cttcattgacttcatctcatccagtgcagcaaggatgtccatctctcttttggaatccagggttctattctctaacgacttcattgcatctcccatttct |
1838858 |
T |
|
| Q |
106 |
tcggcttccctcttctttttcctttcgtcgctttccttatcctctgcgcgccaaggttcaaaatttctcgttgcaccaaactcaacgacgtaatctgaat |
205 |
Q |
| |
|
||||||||||||||||||||| |||| || |||||| ||||||||| |||||||||||||||||||| || |||||| ||||||| || |||||||||| |
|
|
| T |
1838857 |
tcggcttccctcttctttttcatttcatcagtttcctcatcctctgcacgccaaggttcaaaatttctggtagcaccagactcaacaacataatctgaat |
1838758 |
T |
|
| Q |
206 |
tccgcggatcagtcttcatggtatattcagctgagcagcaggtgcatttgccatagaatctgaaaatttgaattccaagatatgtct |
292 |
Q |
| |
|
|| |||||||||||||||||||| |||||| || || | |||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
1838757 |
tctgcggatcagtcttcatggtaagttcagccgaacaccgggtgcatttgaaatagaatctgaaaatttgaattcccagatatgtct |
1838671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University