View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16225_low_2 (Length: 683)
Name: NF16225_low_2
Description: NF16225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16225_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 534; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 534; E-Value: 0
Query Start/End: Original strand, 10 - 567
Target Start/End: Complemental strand, 19857199 - 19856642
Alignment:
| Q |
10 |
tcatagggcaatggggtttgctccatatggagagtactggaggaatttgaggaggatttcttcaacccatttgttttgtcctaggaggattaatgggttt |
109 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19857199 |
tcatagggcaatggggtttgctccgtatggagagtactggaggaatttgaggaggatttcttcaacccatttgttttgtcctaggaggattaatgggttt |
19857100 |
T |
|
| Q |
110 |
gaaggttttaggagtgaggttggtttgaaaatggttgagaggattaagtttttgatgggtgatatgggtagtgttgaggtgaaaaaagttcttcattttg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19857099 |
gaaggttttaggagtgaggttggtttgaaaatggtggagaggattaagtttttgatgggtgatatgggtagtgttgaggtgaaaaaagttcttcattttg |
19857000 |
T |
|
| Q |
210 |
gttcacttaataatgtgatgatgactgtgtttggaaaatgttatgatttctttgatggtgatggttttgagcttgaggagttggtgagtgaaggttatga |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
19856999 |
gttcacttaataatgtgatgatgactgtgtttggaaaatgttatgatttctttgatggtgatggtgttgagcttgaggagttggtgagtgaagggtatga |
19856900 |
T |
|
| Q |
310 |
gctgttgggtgtttttaactggagtgatcattttcctcttctgggttggttggatttgcagggtgttaggaaaaggtgtagagctttggtgaaaaaggtt |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
19856899 |
gctgttgggtgtttttaactggagtgatcattttcctcttctgggttggttggatttgcagggtgttaagaaaaggtgtagagctttggtgacaaaggtt |
19856800 |
T |
|
| Q |
410 |
aatacttttgttggaaagataatagaggagcataagatgaagagaatgtctgaaggaagggctatagttggtgattttgttgacgttttgcttgatttgg |
509 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19856799 |
aatacttttgttggaaagataatagaggagcataagatgaagagaatgtctgaaggaagggctatagttggtgattttgttgacgttttgcttgatttgg |
19856700 |
T |
|
| Q |
510 |
aggaaaaagacaagctcagtgattctgatatgattgcagttctttgggtaatacaata |
567 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19856699 |
aggaaaaagacaagctcagtgattctgatatgattgcagttctttgggtaatacaata |
19856642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University