View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16225_low_9 (Length: 235)
Name: NF16225_low_9
Description: NF16225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16225_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 17 - 220
Target Start/End: Original strand, 41655127 - 41655338
Alignment:
| Q |
17 |
atttcgtagaaacatcatgtttagacagttaattata----atttgtcgcttggattagatatttgagccttgagggttaaactgtcaattttatgcata |
112 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41655127 |
atttcgcagaaacatcatgtttagacagttaattatatataatttgtcgcttggattagatatttgagccttgagggttaaactgtcaattttatgcata |
41655226 |
T |
 |
| Q |
113 |
tcaaatagatgttttaaaaacaataaaaataatttgcttgctattt----tatggacctgttgatatgtgccttcaattaagttaccataatttgactct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41655227 |
tcaaatagatgttttaaaaacaataaaaataatttgcttgctattttatatatggacctgttgatatgtgccttcaattaagttaccataatttgactct |
41655326 |
T |
 |
| Q |
209 |
gaaacaactttt |
220 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41655327 |
gaaacaactttt |
41655338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University