View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16226_low_13 (Length: 288)
Name: NF16226_low_13
Description: NF16226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16226_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 20 - 122
Target Start/End: Complemental strand, 29727181 - 29727079
Alignment:
| Q |
20 |
atttgaatgactttagtttggagtaactctaagggatgcattaagtggtatttggatttcttctattgtgcattatctatttggactctttttgcagcta |
119 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| | |||||| ||||||| |
|
|
| T |
29727181 |
atttgaatgactttagtttcgagtaactctaagggatgcattaagtggtatttggatttcttctctagtgcattatctatttgcattcttttagcagcta |
29727082 |
T |
 |
| Q |
120 |
aac |
122 |
Q |
| |
|
||| |
|
|
| T |
29727081 |
aac |
29727079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University