View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16226_low_13 (Length: 288)

Name: NF16226_low_13
Description: NF16226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16226_low_13
NF16226_low_13
[»] chr8 (1 HSPs)
chr8 (20-122)||(29727079-29727181)


Alignment Details
Target: chr8 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 20 - 122
Target Start/End: Complemental strand, 29727181 - 29727079
Alignment:
20 atttgaatgactttagtttggagtaactctaagggatgcattaagtggtatttggatttcttctattgtgcattatctatttggactctttttgcagcta 119  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| | |||||| |||||||    
29727181 atttgaatgactttagtttcgagtaactctaagggatgcattaagtggtatttggatttcttctctagtgcattatctatttgcattcttttagcagcta 29727082  T
120 aac 122  Q
    |||    
29727081 aac 29727079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University