View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16226_low_15 (Length: 255)
Name: NF16226_low_15
Description: NF16226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16226_low_15 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 9 - 255
Target Start/End: Complemental strand, 43546600 - 43546368
Alignment:
| Q |
9 |
agcacagatatggggagtaaggaaaatgtgaatagttgcttgttaaggatacaacaagatactgctttaagtagaggaagaaaatgtgagtgagctgatg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43546600 |
agcacagatatggggagtaaggaaaatgtgaatagttgcttgttaaggatacaacaagatactgctttaagtagaggaagaaaatgtg------------ |
43546513 |
T |
|
| Q |
109 |
tgtatgtgacatgtctcaatgctgtttatggaaaataaatattcatgcaatcaaggaatttactttgctttccatttatattacgtatatcctctcaaaa |
208 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43546512 |
--tatgtgacatgtctcattgctgtttatggaaaataaatattcatgcaatcaaggaatttactttgccttccatttatattacgtatatcctctcaaaa |
43546415 |
T |
|
| Q |
209 |
acaaattctaattacgtatattccgctatatctacgttttattactc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43546414 |
acaaattctaattacgtatattccgctatatctacgttttattactc |
43546368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University