View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16227_high_10 (Length: 341)
Name: NF16227_high_10
Description: NF16227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16227_high_10 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 14 - 341
Target Start/End: Original strand, 3684985 - 3685312
Alignment:
| Q |
14 |
agagagggcttgaaagacgaggatgatatctggacaacaaaatccttggaccttcgcctttgggtatcttatagaggtcaaacattgtctcgcacagtca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3684985 |
agagagggcttgaaagacgaggatgatatctggacaacaaaatccttggaccttcgcctttgggtatcttacagaggtcaaacattgtctcgcacagtca |
3685084 |
T |
|
| Q |
114 |
gggggatgatgtactattatagcgcccttaagatgctcgcttttcttgattcagcatctgagatggatgtaagacagggatccgagcatattacttcata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685085 |
gggggatgatgtactattatagcgcccttaagatgctcgcttttcttgattcagcatctgagatggatgtaagacagggatccgagcatattacttcata |
3685184 |
T |
|
| Q |
214 |
tggttcaacaaacgcaaacaaccgtctgaatactctacgctctgatgtgcatccatctctacggaagttgcgaagggcagatagcagtgtgaccctgtta |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685185 |
tggttcaacaaacgcaaacaaccgtctgaatactctacgctctgatgtgcatccatctctacggaagttgcgaagggcagatagcagtgtgaccctgtta |
3685284 |
T |
|
| Q |
314 |
ttcaagggagatgaatatgggagtgcga |
341 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
3685285 |
ttcaagggagatgaatatgggagtgcga |
3685312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University