View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16227_high_6 (Length: 357)
Name: NF16227_high_6
Description: NF16227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16227_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 343
Target Start/End: Original strand, 52926087 - 52926429
Alignment:
| Q |
1 |
cagcatttactctggtgattgcggagcggtgagcacgatcctcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagggtggaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926087 |
cagcatttactctggtgattgcggagcggtgagcacgatcttcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagggtggaac |
52926186 |
T |
 |
| Q |
101 |
gggagcatcctgtgggttggtttcagcagcaacagtactgagtgcttggtcaagaacataaatgaaagaggaagaatcgaagtcttgttgagagcgatag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926187 |
gggagcatcctgtgggttggtttcagcagcaacagtactgagtgcttggtcaagaacataaatgaaagaggaagaatcgaagtcttgttgagagcgatag |
52926286 |
T |
 |
| Q |
201 |
caaacaaagagaccgcaaccgatgcaattcatgcggaattgtttctcgagtttgccttggccacgctttaagagaacgttgccagcttcgtgaatattga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926287 |
caaacaaagagaccgcaaccgatgcaattcatgcggaattgtttctcgagtttgccttggccacgctttaagagaacgttgccagcttcgtgaatattga |
52926386 |
T |
 |
| Q |
301 |
atcttgcaagatgtttggtcttatccaaaacgtaagctctgtc |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926387 |
atcttgcaagatgtttggtcttatccaaaacgtaagctctgtc |
52926429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University