View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16229_high_2 (Length: 425)
Name: NF16229_high_2
Description: NF16229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16229_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 1e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 64 - 217
Target Start/End: Complemental strand, 28409236 - 28409083
Alignment:
| Q |
64 |
ggttgatgttggcgatgattgttgaatctttgggatgtcagtatttcattatgatgcctttgaaatccccatgtttatctnnnnnnncattaaagtctgg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28409236 |
ggttgatgttggcgatgattgttgaatctttgggatgtcagtattttattatgatgcctttgaaatccccatgtttatctaaaaagacattaaagtctgg |
28409137 |
T |
 |
| Q |
164 |
tccctcaataaaagctttaaaattggaatggtttgattgtatattgataaaatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28409136 |
tccctcaataaaagctttaaaattggaatggtttgattgtatattgataaaatc |
28409083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University