View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1622_high_18 (Length: 236)
Name: NF1622_high_18
Description: NF1622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1622_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 35165448 - 35165657
Alignment:
| Q |
1 |
tgtcacaacgtgaattacttgtcctatctcttttcttccaactccttattcttcaaatagctttatatcccttctgtccttgtatgttttttcatatttc |
100 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||| | ||||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||| |
|
|
| T |
35165448 |
tgtcacaatgtgaattacttgacctatctcttttctgctaactccttattcttcaaatagctgtatatcccttctttccttgtatgttttctcatatttg |
35165547 |
T |
|
| Q |
101 |
aactagaaatatttctc--tcttgtgggatctctgggagaatggcaatgccttcatttgagcctgaattagttttgcttctatccttatttattcttttg |
198 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35165548 |
aactagaaatatttctctctcttgtgggagctctgggagaatggcaatgccttcatttgagcctgaattagttttgcttctatccttatttattcttttg |
35165647 |
T |
|
| Q |
199 |
atttcggata |
208 |
Q |
| |
|
|||||||||| |
|
|
| T |
35165648 |
atttcggata |
35165657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University