View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1622_low_16 (Length: 279)
Name: NF1622_low_16
Description: NF1622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1622_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 20 - 270
Target Start/End: Complemental strand, 45563237 - 45562985
Alignment:
| Q |
20 |
tgtacgatgtctcatatttttattccattatttaattgacaaacatgtttataaacttacaaatttaaagaattaattaacaggagcaatatcactctta |
119 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45563237 |
tgtacgatgtctcatatttttattcgattatttaattgacaaacatgtttataaacttacaaatttaaagaattaattaacaggagcaatatcactctta |
45563138 |
T |
|
| Q |
120 |
cgcg--atgctgatatggatttacatatctgcagtttctaatgataatgctacaatgtgattttttgttttgaatggacgaaaacatggtttaataaata |
217 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45563137 |
cgcgcgatgctgatatggatttacatatctgcagtttctaatgataatgctacaatgtgattttttgttttgaatggacgaaaacatggtttaataaata |
45563038 |
T |
|
| Q |
218 |
aaggttatctcaactcaagatcataacattgtttcaacaagagctagtattat |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45563037 |
aaggttatctcaactcaagatcataacattgtttcaacaagagctagtattat |
45562985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University