View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1622_low_17 (Length: 275)
Name: NF1622_low_17
Description: NF1622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1622_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 101 - 262
Target Start/End: Complemental strand, 14272369 - 14272200
Alignment:
| Q |
101 |
gtcactaatttggaaaaggatttcataatttttctctca-------tcgttcttttgctatgtttgttggaattgnnnnnnnn-gccgtttgcacataag |
192 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
14272369 |
gtcactactttggaaaaggatttcataatttttctctcaattattctcgttcttttgctgtgtttgttggaattgaaaaaaaaagccgtttgcacataag |
14272270 |
T |
 |
| Q |
193 |
ctacaatctctagaatttagcttttgcgttaaaatttgtctcagaagatgtgtttaaacgtgattcttga |
262 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
14272269 |
ctacaatctctagaatttagcttttgcgctaaaatttgtattggaagatgtgtttaaacgtgattcttga |
14272200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 177 - 262
Target Start/End: Original strand, 25414826 - 25414911
Alignment:
| Q |
177 |
gccgtttgcacataagctacaatctctagaatttagcttttgcgttaaaatttgtctcagaagatgtgtttaaacgtgattcttga |
262 |
Q |
| |
|
|||||||||| | |||||||||| | ||||||| || |||||| |||||||||| | || |||||||| |||||||||||||| |
|
|
| T |
25414826 |
gccgtttgcatagaagctacaatatgtagaattcagtttttgctttaaaatttgcattgaaaaatgtgtttcaacgtgattcttga |
25414911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University