View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1622_low_19 (Length: 245)
Name: NF1622_low_19
Description: NF1622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1622_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 3469557 - 3469782
Alignment:
| Q |
1 |
ctgcaagaagaatcgaaactggagaccgaagagctgcggccggggaagagagattctccggtttgcaaaggaaacaaataatatcgaccatgcaaacttt |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3469557 |
ctgcaagaagaatcggaactggagaccgaagagctgcggccggggaagagagattctccggtctgcaaaggaaacaaataatatcgaccatgcaaacttt |
3469656 |
T |
 |
| Q |
101 |
tccgatacatttgcaatgaaattcaaagtcctctttgattagggtttgaggaggttttctgttgatggaatggtgacaattccaaacgctgatgtaggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3469657 |
tccgatacatttgcaatgaaattcaaagtcctctttgattagggtttgaggaggttttctgttgatggaatggtgacaattccaaacgctgatgtaggat |
3469756 |
T |
 |
| Q |
201 |
tcagcgtgtttcttgatggcgttaag |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
3469757 |
tcagcgtgtttcttgatggcgttaag |
3469782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 51 - 100
Target Start/End: Original strand, 33554729 - 33554778
Alignment:
| Q |
51 |
agattctccggtttgcaaaggaaacaaataatatcgaccatgcaaacttt |
100 |
Q |
| |
|
||||| || |||||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
33554729 |
agattttctggtttgcaaaggtaacaaataacatcaaccatgcaaacttt |
33554778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University