View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16231_high_11 (Length: 430)
Name: NF16231_high_11
Description: NF16231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16231_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 10 - 283
Target Start/End: Complemental strand, 35562198 - 35561925
Alignment:
| Q |
10 |
atcatcaatgttttcttctctatgcaatacaatcgtgtgactattgcattatgcctcaatgatgattttgcttgtttatggtggttgatggaatgatgtt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35562198 |
atcatcaatgttttcttctctatgcaatataattgtgtgactattgcattatgcctcaatgatgattttgcttgtttatggtggttgatggaatgatgtt |
35562099 |
T |
 |
| Q |
110 |
tataactttggtgtgaaactttctaaagtacaagtcaatataattggttttgagaaaactcccaactaggctaaatttgtttagaagaaaaataaatatc |
209 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35562098 |
tataactttcgtgtgaaactttctaaagtacaagtcaatataattggtcttgagaaaactcccaactaggctaaatttgtttagaagaaaaataaatatc |
35561999 |
T |
 |
| Q |
210 |
gattctaattctaatagttgtgtaacgtgggagtcaagaatcgagattgctattgttctcaagatgcgaattcc |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35561998 |
gattctaattctaatagttgtgtaacgtgggagtcaagaatcgagattgctattgttctcaagatgcgaattcc |
35561925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 361 - 415
Target Start/End: Complemental strand, 35561910 - 35561856
Alignment:
| Q |
361 |
ttcataaggaatttcatttcttttgaggtgaggaggtaaaagaagggaaatgact |
415 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35561910 |
ttcataaggaaattcatttcttttgaggtgaggaggtaaaagaagggaaatgact |
35561856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University