View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16231_high_14 (Length: 373)
Name: NF16231_high_14
Description: NF16231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16231_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 12 - 352
Target Start/End: Complemental strand, 43356890 - 43356548
Alignment:
| Q |
12 |
aagaaagagggcgaggttttgagaatgacttgtatggaggattgtgagtatagattaagagctagatcaattgggttggagataagttttctcttttagt |
111 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43356890 |
aagaaagagggtgaggatttgagaatgacttgtatggaggattgtgagtatagattaagagctagatcaattgggttggagataagttttctcttttagt |
43356791 |
T |
 |
| Q |
112 |
ttctattgactatataaagtagaaaatgaaaggctttgttgtgttgagttgctttatcaaaattcaaaagtcattttgaatgatcactgcatggtgtggg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43356790 |
ttctattgactatataaagtagaaaatgaaaggctttgttgtgttgagttgctttatcaaaattcaaaagtcattttgaatgatcactgcatggtgtggg |
43356691 |
T |
 |
| Q |
212 |
ggcaaaagcagctatacccactatccatcatcttttatcatatt--agaggactgacactttacccaccatttggtggtgcctcaatcatggtattgtat |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43356690 |
ggcaaaagcagctatacccactatccatcatcttttatcatattagagaggactgacactttacccaccatttggtggtgcctcaatcatggtattgtat |
43356591 |
T |
 |
| Q |
310 |
aaagtatctatatgattgatatatgttatgtgattaatgtgac |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43356590 |
aaagtatctatatgattgatatatgttatgtgattaatgtgac |
43356548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University