View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16231_low_15 (Length: 393)
Name: NF16231_low_15
Description: NF16231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16231_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 21 - 387
Target Start/End: Complemental strand, 2926620 - 2926252
Alignment:
| Q |
21 |
tttaatacattgcctagacgtagatctgtttgatctctgtatcagcgacacttttaatcgaagacttgtacataatgttgtcgatgcgtctgt-----gt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |
|
|
| T |
2926620 |
tttaatacattgcctagacgtagatctgtttgatctctgtatcagcgacacttttaatggaagacttgtacataatgttgtcgatgcgtctgttgcgtgt |
2926521 |
T |
 |
| Q |
116 |
ctgtgtctatgctgcatagtcttgcgatatatatgtgattata-aaatatttgatgtgttttgtgtgcgtgtgtggttgatgcagtggtgttggttatgt |
214 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2926520 |
ctgtgtctatgatgcatagtcttgcgatatatatgtgattatacaaatatttgatgtgttttgtgtg----tgtggttgatgcagtggtgttggttatgt |
2926425 |
T |
 |
| Q |
215 |
ggcatatcgcgagttttatccatcggaagtggaggcggttaccgataggaaaaaagtggtggtgttgggaacaggatgggcggcaacaagttttatgaag |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2926424 |
ggcatatcgcgagttttatccatcggaagtggaggcggttaccgataggaaaaaagtggtggtgctgggaacaggatgggcggcaacaagttttatgaag |
2926325 |
T |
 |
| Q |
315 |
aatctggacagtccaaagtatgaagtacaggtggtttcgcctcgtaactattttgcattcactcctttgcttc |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2926324 |
aatctggacagtccaaagtatgaagtacaggtggtttcgcctcgtaactattttgcattcactcctttgcttc |
2926252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University