View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16231_low_24 (Length: 238)
Name: NF16231_low_24
Description: NF16231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16231_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 12 - 221
Target Start/End: Original strand, 42955249 - 42955467
Alignment:
| Q |
12 |
attattctggggggcgatttacaagattattagttgatttatttgttggcaatgtttcaaaatgcagttctttatgtttggtgtaatatactctcttgca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42955249 |
attattctggggggcgatttacaagattattagttgatttatttgttggcaatgtttcaaaatgcagttctttatgtttggtgtaatatactctcttgca |
42955348 |
T |
 |
| Q |
112 |
gtccgtatgcagtcaaataaataaactatttacaattatctatgtgattctctcattt---------gtactttattactgtagtgatcgataataattt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42955349 |
gtccgtatgcagtcaaataaataaactatttacaattatctatatgattctctcatttgtacttgtagtactttattactgtagtgatcgataataattt |
42955448 |
T |
 |
| Q |
203 |
atggagttctttcaaaaac |
221 |
Q |
| |
|
||||||||||| ||||||| |
|
|
| T |
42955449 |
atggagttcttacaaaaac |
42955467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University