View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16232_low_14 (Length: 353)
Name: NF16232_low_14
Description: NF16232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16232_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 23 - 337
Target Start/End: Original strand, 44474222 - 44474536
Alignment:
| Q |
23 |
tgaacctgttaaaaatagcgtgtgagcgccaccacaagcaattgcttgaacgttttgattatggaaggaggtgcaaatagcaggtttccattgagaattc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44474222 |
tgaacctgttaaaaatagcgtgtgagcgccaccacaagcaattgcttgaacgttttgattatggaaggaggtgcaaatagcaggtttccattgagaattc |
44474321 |
T |
|
| Q |
123 |
aaattaccgagacccaatctaccgtaatcgccgttgccccataacgcagcgaatctctttcccggttcagaggagaatgatcgtgtaagaaaccctaacc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44474322 |
aaattaccgagacccaatctaccgtaatcaccgttgccccataacgcagcgaatctctttcccggttcagaggagaatgatcgtgtaagaaaccctaacc |
44474421 |
T |
|
| Q |
223 |
ctgaagcacaagttctgaggttgagtttggatgatgatgatgataaacggtgccacatttcggcttagaaattaaggaagttgtttgttgatttgaagaa |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44474422 |
ctgaagcacaagttctgaggttgagtttggatgatgatgatgataaacggtgccacatttcggcttagaaattaaggaagttgttttttgatttgaagaa |
44474521 |
T |
|
| Q |
323 |
gaagaataaatcatc |
337 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
44474522 |
gaagaataaatcatc |
44474536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University