View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16232_low_16 (Length: 333)
Name: NF16232_low_16
Description: NF16232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16232_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 107 - 317
Target Start/End: Complemental strand, 43615035 - 43614825
Alignment:
| Q |
107 |
gttgctctagtactactacttcttttatttatgatagttcttttatttttaaccctccaacttttagaaaaaattagttcgagtgatttgagttcaactc |
206 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43615035 |
gttgctctagtactactgcttcttttatttatgatagttcttttatttttaaccctccaacttttagaaaaaattagttcaagtgatttgagttcaactc |
43614936 |
T |
|
| Q |
207 |
agagatgagtaaaaactagctaaagattgtttcaaaataagttcggtggaactcacatgaattttattcggtaaagagtgagtgttaaaaatatagagtg |
306 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43614935 |
aaagatgagtaaaaactagctaaagattgtttcaaaataagttcggtgaaactcacatgaattttattcggttaagagtgagtgttaaaaatatagagtg |
43614836 |
T |
|
| Q |
307 |
aatgttggtag |
317 |
Q |
| |
|
||||||||||| |
|
|
| T |
43614835 |
aatgttggtag |
43614825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 43615141 - 43615077
Alignment:
| Q |
1 |
agtcacagtttacagtgcgatgttcaacagatactccatgttacatgctggctctggtccaaact |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
43615141 |
agtcacactttacagtgcgatgttcaacagatacaccatgttacatgctagctctggtccaaact |
43615077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University