View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16232_low_29 (Length: 251)
Name: NF16232_low_29
Description: NF16232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16232_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 19315910 - 19315692
Alignment:
| Q |
19 |
ctggaaccattaggggatgttgtgtcaggcagagatgtaattgatatgtgtcgttgttgggagtttgggttgggcccagtcctctgagctgtgtcttgtt |
118 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19315910 |
ctggaaccattaggggatgttgtgtaaggcagagatgcaattgatatgtgt---tgttgggagtttgggatgggcccagtcctctgagctgtgtcttgtt |
19315814 |
T |
|
| Q |
119 |
taaagtgaaaattaccctagaaacagtaaaagtgcacccttataataacctaatttcaagtttcaaacaactacaagtttttatgtatttgatgatatct |
218 |
Q |
| |
|
||| ||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19315813 |
taaggtgaaaattaccctacaaaaagtaaaagtgcacccttataataacctaatttcaagtttcaaacaactacaagtttttatgtatttgatgatatct |
19315714 |
T |
|
| Q |
219 |
gaatttgaaaattgtcattcat |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
19315713 |
gaatttgaaaattgtcattcat |
19315692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University