View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16232_low_30 (Length: 250)
Name: NF16232_low_30
Description: NF16232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16232_low_30 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 9 - 250
Target Start/End: Complemental strand, 56313227 - 56312988
Alignment:
| Q |
9 |
gagatgaaaggaattaattaatttgtggtcagaatttaaaaattcatgcatgaaatagtacatgtgtatgtatgtatgcgagaaaagnnnnnnnnnnnnn |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
56313227 |
gagatgaaaggaattaattaatttgtggtcagaattttaaaattcatgcatgaaatagtacatgtgtatgtatgtatgcgagagaaggagagagagagag |
56313128 |
T |
|
| Q |
109 |
nnnnnattaatcacaaacggtgatagttgttgtatgaatatattttaggcactgtttaatttgtactctctttctttctttaatttctatcacgtaataa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56313127 |
aga--attaatcacaaacggtgatagttgttgtatgaatatattttaggtactgtttaatttgtactctctttctttctttaatttctatcacgtaataa |
56313030 |
T |
|
| Q |
209 |
ttaattgctcactctctccctcttgcattcttggcttctaac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56313029 |
ttaattgctcactctctccctcttgcattcttggcttctaac |
56312988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University