View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16233_high_13 (Length: 225)

Name: NF16233_high_13
Description: NF16233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16233_high_13
NF16233_high_13
[»] chr3 (2 HSPs)
chr3 (23-212)||(198083-198272)
chr3 (92-212)||(203684-203804)
[»] chr4 (2 HSPs)
chr4 (92-212)||(6904681-6904801)
chr4 (123-168)||(6903260-6903305)


Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 23 - 212
Target Start/End: Original strand, 198083 - 198272
Alignment:
23 ggagaggtcaatgcaaatggaaccataaatataaatcataccgtaactttaaaaaccagaaagtaattaaaatccttactgcataaaagcccctgttgga 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
198083 ggagaggtcaatgcaaatggaaccataaatataaatcataccgtaactttaaaaaccagaaagtaattaaaatccttactgcataaaagcccctgttgga 198182  T
123 ttttgaataaaaatatgggttttttgggttgaattcactggcagcacaattttctcttttggaagcagagttgggaccctttatcctttg 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
198183 ttttgaataaaaatatgggttttttgggttgaattcactggcagcacaattttctcttttggaagcagagttgggaccctttatcctttg 198272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 92 - 212
Target Start/End: Complemental strand, 203804 - 203684
Alignment:
92 aaatccttactgcataaaagcccctgttggattttgaataaaaatatgggttttttgggttgaattcactggcagcacaattttctcttttggaagcaga 191  Q
    ||||||| || ||| ||| |||| || |||||||||||| |||||| |||||||||||||||||||||| | ||||||||||| ||||||||||| ||||    
203804 aaatcctcaccgcaaaaatgcccttgatggattttgaatgaaaataagggttttttgggttgaattcaccgacagcacaatttgctcttttggaatcaga 203705  T
192 gttgggaccctttatcctttg 212  Q
    ||| ||||||||||| |||||    
203704 gttaggaccctttatgctttg 203684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 92 - 212
Target Start/End: Original strand, 6904681 - 6904801
Alignment:
92 aaatccttactgcataaaagcccctgttggattttgaataaaaatatgggttttttgggttgaattcactggcagcacaattttctcttttggaagcaga 191  Q
    ||||||| || ||| ||| |||| || |||||||||||| |||||| |||||||||||||||||||||| ||||||||||||| ||||||||||| ||||    
6904681 aaatcctcaccgcaaaaatgcccttgatggattttgaatgaaaataagggttttttgggttgaattcaccggcagcacaatttgctcttttggaatcaga 6904780  T
192 gttgggaccctttatcctttg 212  Q
    ||| ||||||||||| |||||    
6904781 gttaggaccctttatgctttg 6904801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 168
Target Start/End: Original strand, 6903260 - 6903305
Alignment:
123 ttttgaataaaaatatgggttttttgggttgaattcactggcagca 168  Q
    ||||||| ||||||| ||||||||||| ||||||||| ||||||||    
6903260 ttttgaacaaaaataagggttttttggattgaattcattggcagca 6903305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University