View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16233_high_13 (Length: 225)
Name: NF16233_high_13
Description: NF16233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16233_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 23 - 212
Target Start/End: Original strand, 198083 - 198272
Alignment:
| Q |
23 |
ggagaggtcaatgcaaatggaaccataaatataaatcataccgtaactttaaaaaccagaaagtaattaaaatccttactgcataaaagcccctgttgga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
198083 |
ggagaggtcaatgcaaatggaaccataaatataaatcataccgtaactttaaaaaccagaaagtaattaaaatccttactgcataaaagcccctgttgga |
198182 |
T |
 |
| Q |
123 |
ttttgaataaaaatatgggttttttgggttgaattcactggcagcacaattttctcttttggaagcagagttgggaccctttatcctttg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
198183 |
ttttgaataaaaatatgggttttttgggttgaattcactggcagcacaattttctcttttggaagcagagttgggaccctttatcctttg |
198272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 92 - 212
Target Start/End: Complemental strand, 203804 - 203684
Alignment:
| Q |
92 |
aaatccttactgcataaaagcccctgttggattttgaataaaaatatgggttttttgggttgaattcactggcagcacaattttctcttttggaagcaga |
191 |
Q |
| |
|
||||||| || ||| ||| |||| || |||||||||||| |||||| |||||||||||||||||||||| | ||||||||||| ||||||||||| |||| |
|
|
| T |
203804 |
aaatcctcaccgcaaaaatgcccttgatggattttgaatgaaaataagggttttttgggttgaattcaccgacagcacaatttgctcttttggaatcaga |
203705 |
T |
 |
| Q |
192 |
gttgggaccctttatcctttg |
212 |
Q |
| |
|
||| ||||||||||| ||||| |
|
|
| T |
203704 |
gttaggaccctttatgctttg |
203684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 92 - 212
Target Start/End: Original strand, 6904681 - 6904801
Alignment:
| Q |
92 |
aaatccttactgcataaaagcccctgttggattttgaataaaaatatgggttttttgggttgaattcactggcagcacaattttctcttttggaagcaga |
191 |
Q |
| |
|
||||||| || ||| ||| |||| || |||||||||||| |||||| |||||||||||||||||||||| ||||||||||||| ||||||||||| |||| |
|
|
| T |
6904681 |
aaatcctcaccgcaaaaatgcccttgatggattttgaatgaaaataagggttttttgggttgaattcaccggcagcacaatttgctcttttggaatcaga |
6904780 |
T |
 |
| Q |
192 |
gttgggaccctttatcctttg |
212 |
Q |
| |
|
||| ||||||||||| ||||| |
|
|
| T |
6904781 |
gttaggaccctttatgctttg |
6904801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 168
Target Start/End: Original strand, 6903260 - 6903305
Alignment:
| Q |
123 |
ttttgaataaaaatatgggttttttgggttgaattcactggcagca |
168 |
Q |
| |
|
||||||| ||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
6903260 |
ttttgaacaaaaataagggttttttggattgaattcattggcagca |
6903305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University