View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16234_high_1 (Length: 438)
Name: NF16234_high_1
Description: NF16234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16234_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 7e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 2593955 - 2594091
Alignment:
| Q |
13 |
tatatggatgaatctttgtcaagtttacaaatagatattttttaggcaagtcgtgtcattaaataataactttaggaatacctcaaaattggggaattta |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2593955 |
tatagggatgaatctttgtcaagtttacaaatagatattttttaggcaagtcgtgtcattaaataataactttaggaatacctcaaaattggggaattta |
2594054 |
T |
|
| Q |
113 |
annnnnnnnnctatgcatgtagaattgaattttaagc |
149 |
Q |
| |
|
| ||||||||||||||||||||||||||| |
|
|
| T |
2594055 |
atttttttttctatgcatgtagaattgaattttaagc |
2594091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 245 - 353
Target Start/End: Original strand, 2594220 - 2594326
Alignment:
| Q |
245 |
ttgaataggctaaaataagttaaacaaatgctaccagctaccaagtgtcatatgggtaaaagtcaaaggtaaattttgtcaattaaaattcaatttgtac |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2594220 |
ttgaataggctaaaataagttaaacaaatgctaccagctaccaagtgtcat--gggtaaaagtcaaaggtaaattttgtcaattaaaattcaatttgtac |
2594317 |
T |
|
| Q |
345 |
attattaat |
353 |
Q |
| |
|
||||||||| |
|
|
| T |
2594318 |
attattaat |
2594326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University