View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16235_high_37 (Length: 253)
Name: NF16235_high_37
Description: NF16235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16235_high_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 46557394 - 46557640
Alignment:
| Q |
1 |
tgtaattgttgttcttctggtggtagaggtggtggtgcttcttgaacaactactagttcgggtcttgtttctgttgcttccattgggaagtgaaaagaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46557394 |
tgtaattgttgttcttctggtggtagaggtggtggtgcttcttgaacaactactagttcgggtcttgtttctgttgcttccattgggaagtgaaaagaaa |
46557493 |
T |
 |
| Q |
101 |
caagagcgatgtttagaaagagaaagagaggaggttactaattaagaaca---aggctttaaggttaattttggtatataaaaggtgatcacgaagaaga |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46557494 |
caagagcgatgtttagaaagagaaagagaggaggttactaattaagaacaaggaggctttaaggttaattttggtatataaaaggtgatcacgaagaaga |
46557593 |
T |
 |
| Q |
198 |
atgggaggagaatatcgttagaaattcctagatctttccagaataat |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46557594 |
atgggaggagaatatcgttagaaattcctagatctttccagaataat |
46557640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University