View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16235_high_43 (Length: 238)
Name: NF16235_high_43
Description: NF16235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16235_high_43 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 220
Target Start/End: Complemental strand, 6769067 - 6768863
Alignment:
| Q |
16 |
gaaccgaatagtctaccgtttccacgcataacatgatccacttcacccaccggtcagagaaacccatcttggtcataatatctcggagataatcccaccc |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
6769067 |
gaaccgaatagtctacctattccacgcataacatgatccacttcacccaccggtcagagaaacccattttggtcataatatctcggagataatcccactc |
6768968 |
T |
 |
| Q |
116 |
aatacggtcataagctttactgatgtctagtttgagagcagcatcatattttttacctttcctcttggtcttcatataatgaacaatatcaatggctgcc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6768967 |
aatacggtcataagctttactgatgtctagtttgagagcagcatcatattttttacctttcctcttggtcttcatataatgaacaatatcaatggctgcc |
6768868 |
T |
 |
| Q |
216 |
atggc |
220 |
Q |
| |
|
||||| |
|
|
| T |
6768867 |
atggc |
6768863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 201
Target Start/End: Original strand, 237040 - 237074
Alignment:
| Q |
167 |
tttacctttcctcttggtcttcatataatgaacaa |
201 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
237040 |
tttacctttcgtcttggtcttcatataatgaacaa |
237074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 25597152 - 25597196
Alignment:
| Q |
167 |
tttacctttcctcttggtcttcatataatgaacaatatcaatggc |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
25597152 |
tttaccttttgtcttggtcttcatataatgaacaacttcaatggc |
25597196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University