View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16235_low_22 (Length: 361)
Name: NF16235_low_22
Description: NF16235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16235_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 10 - 347
Target Start/End: Complemental strand, 29279122 - 29278785
Alignment:
| Q |
10 |
agatgaatagtattttcacttattgacattcaagcaccttgatgaaattctactttatttttgtggtttgataagatttgaagatggtgattctccctca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29279122 |
agatgaatagtattttcacttattgacattcaagcaccttgatgaaattctactttatttttgtggtttgataagatttgaagatggtgattctccctca |
29279023 |
T |
|
| Q |
110 |
atgtgtatcatatacatttgtgcaggtattgatggataactttctaggggaaatggtaactaaaactttgaagttattccaagactctcatgttcaagtt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29279022 |
atgtgtatcatatacatttgtgcaggtattgatggataactttctaggggaaatggtaaccaaaactttgaagttattccaagactctcatgttcaagtt |
29278923 |
T |
|
| Q |
210 |
cggttggctgcttttactttgatggagatgcctataaactttgtccaagcggctcaacttctttatcatcataggtttatgcatgccttctccattgcac |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29278922 |
cggttggctgcttttactttgatggagatgcctataaactttgtccaagcggctcaacttctttatcatcataggtttatgcatgccttctccattgcac |
29278823 |
T |
|
| Q |
310 |
ttggcagtgatgaggacaataaagtgaaggtagtatat |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29278822 |
ttggcagtgatgaggacaataaagtgaaggtagtatat |
29278785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University