View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16235_low_27 (Length: 323)
Name: NF16235_low_27
Description: NF16235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16235_low_27 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 12 - 323
Target Start/End: Original strand, 43761940 - 43762251
Alignment:
| Q |
12 |
ttaagatggttttattgtttgattaagttatttgtggtcaatattcaaatcaagacgttattgggggtagagagaagtaggaggtaattgcccactgtgg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43761940 |
ttaagatggttttattgtttgattaagttatttatggtcaatattcaaattaagacgttattgggggtagagagaagtaggaggtaattgcccactgtgg |
43762039 |
T |
|
| Q |
112 |
gggtaaccctgatgttggtagccaaccatgccattgaccttgtgaatttgaggttcaagtcttagaacctcccttttaagatcaggtggttccatgccat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43762040 |
gggtaaccctgatgttggtagccaaccatgccattgaccttgtgaatttgaggttcaagtcttagaacctcccttttaagatcaggtggttccataccat |
43762139 |
T |
|
| Q |
212 |
aatcatcaggtgtgctagacaatgattctatccatgagttcttcttttctttgggatggcaagcatatttataattttaaattgtgaccagtaagtcgat |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43762140 |
aatcatcaggtgtgctagacaatgattctatccacgagttcttcttttctttgggatggcaagcatatttataattttaaattgtgaccagtaagtcgat |
43762239 |
T |
|
| Q |
312 |
tagaagaacatc |
323 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43762240 |
tagaagaacatc |
43762251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University