View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16235_low_37 (Length: 285)
Name: NF16235_low_37
Description: NF16235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16235_low_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 7e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 167 - 270
Target Start/End: Original strand, 421436 - 421539
Alignment:
| Q |
167 |
gctatgctaaatgggttgtgcgcttaaaagatctcactttcaccctaaaaaagctgaacacttttgtctccatctcctcatctctctctaccaataggaa |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
421436 |
gctatgctaaatgggttgtgcgcttaaaagatctcactttcaccctaaaaaagctgaacacttttgtctccatctcctcatctctctctaccaataggaa |
421535 |
T |
|
| Q |
267 |
agtt |
270 |
Q |
| |
|
|||| |
|
|
| T |
421536 |
agtt |
421539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 421276 - 421379
Alignment:
| Q |
1 |
atctaactcatttcatttgattcggagaaaacagtgtgtaatgtaatggcgtgtacattaagtctattatcacacacactctctctctcactatcactat |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
421276 |
atctaactcatttcatttgattcagagaaaacagtgtgtaatgtaatggcgtgtacattaagtctattatcacacaca--ctctctctcactataactat |
421373 |
T |
|
| Q |
101 |
aactat |
106 |
Q |
| |
|
|||||| |
|
|
| T |
421374 |
aactat |
421379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University