View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16235_low_48 (Length: 242)
Name: NF16235_low_48
Description: NF16235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16235_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 23 - 224
Target Start/End: Complemental strand, 48946981 - 48946779
Alignment:
| Q |
23 |
acatttatgttagttatgtgatgtgagtaacttttatatatgcacatacatagtaccttcgctagtttccttgtggcatgtggtgtgttacttggtagta |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48946981 |
acatttatgttagttatgtgatgtgagtaacttttatatatgta------tagtaccttcgctagtttccttgtggcatgtggtgtgttacttggtagta |
48946888 |
T |
 |
| Q |
123 |
atttgaaaagatgtctttgctttgaatttgttaccacatatctaaacatgtggaattcatcaaa-------ggtcatgtattagcacttctttatattgc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48946887 |
atttgaaaagatgtctttgctttgaatttgttaccacatatctaaacatgtggaattcatcaaagtttaatggtcatgtattagcacttctttatattgc |
48946788 |
T |
 |
| Q |
216 |
ccttttcat |
224 |
Q |
| |
|
||||||||| |
|
|
| T |
48946787 |
ccttttcat |
48946779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University