View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16235_low_49 (Length: 238)

Name: NF16235_low_49
Description: NF16235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16235_low_49
NF16235_low_49
[»] chr4 (1 HSPs)
chr4 (18-228)||(43762241-43762451)


Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 43762451 - 43762241
Alignment:
18 aatataaacataaactagggatataaagttaacttggtggttcgagtgagagagttaaggatctccagggtatgatccccacccctagcataatatatac 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
43762451 aatataaacataaactagggatataaagttaacttggtggttcgagtgagagagttaaggatctcgagggtatgatccccacccctagcataatatatac 43762352  T
118 taagaatacatacaacacattactatgtctaaggttggcatgttctgttaaataaaaaagttacgtctaatgcagtaatactacataagcaaaaatgtaa 217  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
43762351 taagaatacatacaacacattactatgtcaaaggttggcatgttctgttaaataaaaaagctacgtctaatgcagtaatactacataagcaaaaatgtaa 43762252  T
218 gatgttcttct 228  Q
    |||||||||||    
43762251 gatgttcttct 43762241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University