View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16235_low_52 (Length: 237)
Name: NF16235_low_52
Description: NF16235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16235_low_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 218
Target Start/End: Complemental strand, 52409332 - 52409131
Alignment:
| Q |
17 |
cacagagtaacatcataagaacagcaccactgccagccaagtcagtggttgaagacgaacttgccccagcaccagctgcaaccgtatcattattaccatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52409332 |
cacagagtaacatcataagaacagcaccactgccagccaagtcagtggttgaagacgaacttgccccagcaccagctgcaaccgtatcattattaccatt |
52409233 |
T |
|
| Q |
117 |
gccaacttcatcacactcgcatcataatcaaactgatcttatactcagcaatcgcaatagcactgattatgatgcttccaaagtacaagtacaagtcaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52409232 |
gccaacttcatcacactcgcatcataatcaaactgatcttatactcagcaatcgcaatagcactgattatgatgcttccaaagtacaagtacaagtcaaa |
52409133 |
T |
|
| Q |
217 |
ca |
218 |
Q |
| |
|
|| |
|
|
| T |
52409132 |
ca |
52409131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University