View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16235_low_53 (Length: 237)
Name: NF16235_low_53
Description: NF16235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16235_low_53 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 96 - 221
Target Start/End: Complemental strand, 45593539 - 45593414
Alignment:
| Q |
96 |
gtccatgtttagagggggaaaagggtggacagagaatggttagatcaatggattaacaactagtgattttgttcacgttcttcaacaactgttgattatg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45593539 |
gtccatgtttagagggggaaaagggtggacagagaatggttagatcaatggattaacaactagtgattttgttcacgtccttcaacaactgttgattatg |
45593440 |
T |
|
| Q |
196 |
tgtaattataatgtcccaggtttcat |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
45593439 |
tgtaattataatgtcccaggtttcat |
45593414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 14 - 62
Target Start/End: Complemental strand, 45593588 - 45593540
Alignment:
| Q |
14 |
ttagttttctcaacctttttgtgatatcttcatttttgaaaaatgcatg |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45593588 |
ttagttttctcaacctttttgtgatatcttcatttttgaaaaatgcatg |
45593540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University