View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16237_high_12 (Length: 247)
Name: NF16237_high_12
Description: NF16237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16237_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 232
Target Start/End: Original strand, 43859933 - 43860154
Alignment:
| Q |
11 |
tgaagagacccttgttttgtagaaggacaggataatagtcattgtcaaatgttgttgagctattaggatccatttcgactgttgtagtggtgtcacttag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43859933 |
tgaagagacccttgttttgtagaaggacaggataatagtcattgtcaaatgttgttgagctattaggatccatttcgactgttgtagtggtgtcacttag |
43860032 |
T |
 |
| Q |
111 |
gccttggcatttggtcttcaagaaatttgcataagttggattcagagatggatcttgatcaccttttccagtgaagttgaaaagcctgttgctgaataag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43860033 |
gccttggcatttggtcttcaagaaatttgcgtaagttggatttagagatggatcttgatcaccttttccagtgaagttgaaaagcctgttgctgaataag |
43860132 |
T |
 |
| Q |
211 |
ttgcaatgtcctactccaattg |
232 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
43860133 |
ttgcaatgtcctactccaattg |
43860154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 11 - 77
Target Start/End: Original strand, 43858262 - 43858328
Alignment:
| Q |
11 |
tgaagagacccttgttttgtagaaggacaggataatagtcattgtcaaatgttgttgagctattagg |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43858262 |
tgaagagacccttgttttgtagaaggacaggataatagtcattgtcaaatgttgttgagctattagg |
43858328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University