View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16237_low_10 (Length: 256)
Name: NF16237_low_10
Description: NF16237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16237_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 157 - 247
Target Start/End: Complemental strand, 42266790 - 42266700
Alignment:
| Q |
157 |
ccttaaaatcttcatgtttgtttgatcttatgtcatttgaaatgtttttgatataaactatgtttggtgtttttctgtgttcgtgtctgtg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42266790 |
ccttaaaatcttcatgtttgtttgatcttatgtcatttgaaatgtttttgatataaactatgtttgatgtttttctgtgttcgtgtctgtg |
42266700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 17 - 89
Target Start/End: Complemental strand, 42266941 - 42266869
Alignment:
| Q |
17 |
caatacccttttcatttctcttcacaataatcttcttcatcagtaagataaaccactctctctctttcaccaa |
89 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42266941 |
caatacccttttcatttctcttcacgataatcttcttcatcagtaagataaaccactctctctctttcaccaa |
42266869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University