View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16237_low_14 (Length: 230)
Name: NF16237_low_14
Description: NF16237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16237_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 25 - 212
Target Start/End: Complemental strand, 40863312 - 40863122
Alignment:
| Q |
25 |
agtatcactaaaataaacaccattgttgcgaacataattaagcctaaaaagtagagacacgggtaagtgttgaatatattatccccgaaactgaaaactt |
124 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40863312 |
agtaccactaaaataaacaccattgttgcgaacataattaagcctaaaaagtagagacacgagtaagtgttgaatatattatccccgaaactgaaaactt |
40863213 |
T |
|
| Q |
125 |
acaccacacttgcttgttgc---atttttcctaccgtccaactccacaccgaatgctaccagcttacaagtttcagtggaaagatcataac |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40863212 |
tcaccacacttgcttgttgcattatttttcctaccgtccaactccacaccgaatgctaccagcttacaagtttcagtggaaagatcataac |
40863122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University