View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16237_low_15 (Length: 222)
Name: NF16237_low_15
Description: NF16237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16237_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 19 - 120
Target Start/End: Complemental strand, 40319372 - 40319271
Alignment:
| Q |
19 |
aaaataggattagacttggagcttaaaacataagctcacttacacgtaaagtgggtgtgagtgaaaaatatgaaataagtacattacggatttaaagctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40319372 |
aaaataggattagacttggagcttaaaacataagctcacttacacgtaaagtgggtgtgagtgaaaaatatgaaataagtacattacggatttaaagctt |
40319273 |
T |
|
| Q |
119 |
ag |
120 |
Q |
| |
|
|| |
|
|
| T |
40319272 |
ag |
40319271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University