View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16237_low_9 (Length: 294)
Name: NF16237_low_9
Description: NF16237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16237_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 35 - 293
Target Start/End: Complemental strand, 42445053 - 42444795
Alignment:
| Q |
35 |
gccgtataaatcaatgcttgaaatgaaaacagggtaacataagaaattggcacnnnnnnnnnnnnnnnnctttggtcttttgcaatcaaaggtacgttat |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42445053 |
gccgtataaatcaatgcttgaaatgaaaacagggtaacataagaaattggcacaaaaaacaaaacaaaactttggtcttttgcaatcaaaggtacgttat |
42444954 |
T |
|
| Q |
135 |
ttcacacttttgttatgagctgttttagtgtttttgttcctgcgatttttccttcaaattttatacccttggtatgtaactatcataaacagaaacatag |
234 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42444953 |
ttcacacctttgttatgaactgttttagtgtttttgttcctgcgatttttccttcaaattttatacccttggtatgtaactatcatgaacagaaacatag |
42444854 |
T |
|
| Q |
235 |
tattgagctcggctcaaactgaatctaatttgattcagcttggctcaactcgatagatt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42444853 |
tattgagctcggctcaaactgaatctaatttgattcagctcggctcaactcgatagatt |
42444795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University