View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_1D_high_16 (Length: 233)
Name: NF1623_1D_high_16
Description: NF1623_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_1D_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 10 - 227
Target Start/End: Original strand, 5171742 - 5171954
Alignment:
| Q |
10 |
atatgaacaaaacacaacggtagttaactgccgctgatattgaatgaacatcaattaactactgtgaataaacgaacgaatgatagttaactgcggttga |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |||||||||||||| ||||| |
|
|
| T |
5171742 |
atatgaacaaaacacagcggtagttaactgccgctgatattgaatgaacatcaattaaatactgtaaataaacgaa----tgatagttaactgccgttga |
5171837 |
T |
|
| Q |
110 |
aatagcaagtgcctaaagagcaattatctttccaactgagtacataactgcctccgctagaggtaacaaagggcccaacataaaagcacagtttatatag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5171838 |
aatagcaagtgcctaaagagcaattatctt-ccaactgagcacataactgcctccgctagaggtaacaaagggcccaacataaaagcacaggttatatag |
5171936 |
T |
|
| Q |
210 |
acacaacaacaaactgtt |
227 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
5171937 |
acacaacaacaaactgtt |
5171954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University