View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1623_1D_high_16 (Length: 233)

Name: NF1623_1D_high_16
Description: NF1623_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1623_1D_high_16
NF1623_1D_high_16
[»] chr5 (1 HSPs)
chr5 (10-227)||(5171742-5171954)


Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 10 - 227
Target Start/End: Original strand, 5171742 - 5171954
Alignment:
10 atatgaacaaaacacaacggtagttaactgccgctgatattgaatgaacatcaattaactactgtgaataaacgaacgaatgatagttaactgcggttga 109  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||    |||||||||||||| |||||    
5171742 atatgaacaaaacacagcggtagttaactgccgctgatattgaatgaacatcaattaaatactgtaaataaacgaa----tgatagttaactgccgttga 5171837  T
110 aatagcaagtgcctaaagagcaattatctttccaactgagtacataactgcctccgctagaggtaacaaagggcccaacataaaagcacagtttatatag 209  Q
    |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
5171838 aatagcaagtgcctaaagagcaattatctt-ccaactgagcacataactgcctccgctagaggtaacaaagggcccaacataaaagcacaggttatatag 5171936  T
210 acacaacaacaaactgtt 227  Q
    ||||||||||||||||||    
5171937 acacaacaacaaactgtt 5171954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University