View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_1D_high_17 (Length: 231)
Name: NF1623_1D_high_17
Description: NF1623_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_1D_high_17 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 231
Target Start/End: Original strand, 25596968 - 25597180
Alignment:
| Q |
19 |
ggagtacggcggtgacttggctgtcaaggatttgaaagctttctgtcaacaacacttaccaatgttttcaaaacggactgacttgaatcaacttgatcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25596968 |
ggagtacggcggtgacttggctgtcaaggatttgaaagctttctgtcaacaacacttaccaatgttttcaaaacggactgacttgaatcaacttgatcaa |
25597067 |
T |
 |
| Q |
119 |
tttagcactgctgaaaagttacctagggtgctgcttctctcaaccaaaaagaacactcctgtaatttggcgtgttcttagtggcttgtatcgcaaacgct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25597068 |
tttagcactgctgaaaagttacctagggtgctgcttctctcaaccaaaaagaacactcctgtaatttggcgtgttcttagtggcttgtatcgcaaacgct |
25597167 |
T |
 |
| Q |
219 |
ttgccttcagtga |
231 |
Q |
| |
|
||||||||||||| |
|
|
| T |
25597168 |
ttgccttcagtga |
25597180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University