View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_1D_low_11 (Length: 350)
Name: NF1623_1D_low_11
Description: NF1623_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_1D_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 329
Target Start/End: Complemental strand, 46999506 - 46999177
Alignment:
| Q |
1 |
ctcttgctcacatataaccttcaccaccatgccgctctttctttttgttgcattgcatgttgttttttggctccataatttgtgttaccttcattgtttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46999506 |
ctcttgctcacatataaccttcaccaccatgccgctctttctttttgttgcattgcatgttgttttttggctccataatttgtgttactgtcattgtttt |
46999407 |
T |
 |
| Q |
101 |
ccaa-caacaccgcatgcatccaatctctgtcacagaggcacaattttccaactaatatcattcaaacgttccttcctacacccgtaaatataaccgcca |
199 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
46999406 |
ccaaacaacaccgcatgcatccaatctctgtcacagaggcacaattttccaactaatatcattcaaacgttccttcctacgccagtaaatataaccgcca |
46999307 |
T |
 |
| Q |
200 |
cgtgtccttctcacacaatgctgattccacacattctcattctcatgtgatggtttccatgaagattttgttggttcaccatttcgtgacacctccttaa |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46999306 |
cgtgtccttctcacacaatgctgattccacacattctcattctcatgtgatggtttccatgaagattttgttggttcaccatttcgtgacacctccttaa |
46999207 |
T |
 |
| Q |
300 |
cattggtattcccctgttttcttcttcttg |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46999206 |
cattggtattcccctgttttcttcttcttg |
46999177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University