View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_1D_low_16 (Length: 281)
Name: NF1623_1D_low_16
Description: NF1623_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_1D_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 164 - 270
Target Start/End: Complemental strand, 21551376 - 21551270
Alignment:
| Q |
164 |
ctaattgtgatgttttcccctcttcaacattttacgtggagattccagatgtatacagtagatctttattttccaccagcataaatatagactagaaatt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21551376 |
ctaattgtgatgttttcccctcttcaacattttacgtggagattccagatgtatacagtagatctttattttccaccagcataaatataggctagaaatt |
21551277 |
T |
|
| Q |
264 |
aataaca |
270 |
Q |
| |
|
||||||| |
|
|
| T |
21551276 |
aataaca |
21551270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 7 - 69
Target Start/End: Complemental strand, 21551549 - 21551487
Alignment:
| Q |
7 |
aatgcagccttgagcctcactatggttgactgtgcatgagttcgcatatgtgtgttcctttgg |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21551549 |
aatgcagccttgagcctcactatggttgactgtgcatgagttcgcatatgtgtgttcctttgg |
21551487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University