View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_1D_low_19 (Length: 276)
Name: NF1623_1D_low_19
Description: NF1623_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_1D_low_19 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 22 - 276
Target Start/End: Original strand, 15429553 - 15429811
Alignment:
| Q |
22 |
actttggattactgggttcccctttcccttgggaactgg-gggttaccgtaaagnnnnnnnn---ctccaagcgcccacaagtgcacatcatgtatatca |
117 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||| ||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15429553 |
actttggattactgggtccccctttccgttgggaattggagggttaccgtaaataaaataaaaaactccaagcgcccacaagtgcacatcatgtatatca |
15429652 |
T |
|
| Q |
118 |
ttgtaataaaaagttattgatctgcaatgacttgtgattatcaagtgtttagctagattttgtttttctcgcaatctaattaagatctcttatcattagc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15429653 |
atgtaataaaaagttattgatctgcaatgacttgtgattatcaagtgtttagctagattttgtttttctcgcaatctaattaagatctcttatcattagc |
15429752 |
T |
|
| Q |
218 |
gatcggtgaattgtgaacagtgccaacaagaccacataaattacccacgttgtcatttt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15429753 |
gatcggtgaattgtgaacagtgccaacaagaccacataaattacccacgttgtcatttt |
15429811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University