View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_1D_low_24 (Length: 237)
Name: NF1623_1D_low_24
Description: NF1623_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_1D_low_24 |
 | |
|
| [»] scaffold0009 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0009 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 2 - 237
Target Start/End: Original strand, 34458 - 34690
Alignment:
| Q |
2 |
gctttgtctcctttatatacagatttatcgtcacctagttctagggtacaaaattattgttattgttgttaccattatcttataagcacttatgttatct |
101 |
Q |
| |
|
||||||||||||||||| || |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34458 |
gctttgtctcctttata--caaatttatcgtcgcctagttctagggtacaaaattattgttattgttgttaccattatcttataagcacttatgtaatct |
34555 |
T |
|
| Q |
102 |
ttactacaatattcaatcgttggcatctgaaacttctttgttagaagattattaatacaataaaacaaaacttggacaaatgtgagaggtttcaaagata |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34556 |
ttactacaatattcaatcgttggcatctgaaacttctttgttagaagaatattaatataataaaacaaaacttggacaaatgtgagaggtttcaaagata |
34655 |
T |
|
| Q |
202 |
ctttgcagttttttgacatgccattttgattgaagg |
237 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34656 |
ctttgcagttttttgacatgcca-tttgattgaagg |
34690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University