View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_1D_low_29 (Length: 229)
Name: NF1623_1D_low_29
Description: NF1623_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_1D_low_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 2819668 - 2819458
Alignment:
| Q |
1 |
aatgtagctggaggtgttccaatgagtccattgcaagctaatcttccatcacaatccccagtttcacaagatggtttccaattatttgaagcaaaattgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2819668 |
aatgtagctggaggtgttccaatgagtccattgcaagctaatcttccatcacaatccccagtttcacaagatggtttccaattatttgaagcaaaattgc |
2819569 |
T |
|
| Q |
101 |
aacctgttctagcccaaattctaccactccatgaccatggtgctagaattttctttgtttggcctgaaggaaggtagaatccaccatctgctataattgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2819568 |
aacctgttctagcccaaattctaccactccatgaccatggtgctagaattttctttgtttggcctgaaggaaggtagaatccaccatctgctataattgg |
2819469 |
T |
|
| Q |
201 |
ttgaccagtgt |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
2819468 |
ttgaccagtgt |
2819458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University