View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_1D_low_32 (Length: 222)
Name: NF1623_1D_low_32
Description: NF1623_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_1D_low_32 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 222
Target Start/End: Complemental strand, 23333847 - 23333637
Alignment:
| Q |
12 |
ggacatcacgaagttgaccgataaaattgtgtgccagaatgcagctgaagcagtactcccccaaagaggttgataagtttgttttatgtaattttttgct |
111 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333847 |
ggacataacgaagttgaccgataaaattgtgtgccggaatgcagctgaagcagtactccccccaagaggttgataagtttgttttatgtaattttttgct |
23333748 |
T |
|
| Q |
112 |
gttttgatatattgtgacatgatttaccaggaaaaatgtacacattgtcgttacctcaggaactgttgttcgtgttgctgatgagctttcccttcaagag |
211 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333747 |
gttttgatatattgtgtcatgatttaccaggaaaaatgtacacattgtcgttgcctcaggaactgttgttcgtgttgctgatgagctttcccttcaagag |
23333648 |
T |
|
| Q |
212 |
atgcgattgct |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
23333647 |
atgcgattgct |
23333637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University