View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_1D_low_40 (Length: 202)
Name: NF1623_1D_low_40
Description: NF1623_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_1D_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 23 - 191
Target Start/End: Complemental strand, 44676881 - 44676712
Alignment:
| Q |
23 |
cttgtcactaa-gtcttctcattgtctcgtctttgttcccctctcatttgtgacttcccaaatgctaaattcctcctattcatttttggtaatatactgc |
121 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44676881 |
cttgtcactaaagtcttctcattgtctcgtctttgttcccctctcatttgtgacttcccaaatgctaaattcctcctattcatttttggtaatatactgc |
44676782 |
T |
 |
| Q |
122 |
tatgattattctctatttactcattctcaccccttttgtttctttctttttcttggtcaacattcttcat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44676781 |
tatgattattctctatttactcattctcaccccttttgtttctttctttttcttggtcaacattcttcat |
44676712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University