View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_2D_high_29 (Length: 428)
Name: NF1623_2D_high_29
Description: NF1623_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_2D_high_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 5e-60; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 278 - 407
Target Start/End: Original strand, 116510 - 116639
Alignment:
| Q |
278 |
acagatcatgtaacccagacgatgaattacttattactgtgttttttgagaccggattctcagtggtggctagcatatcaaacacctaagtcttattcga |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
116510 |
acagatcatgtaacccagacgatgaattacttattactgtgttttttgagaccaggttctcagtggtggctagcatatcaaacacctaagtcttattcga |
116609 |
T |
|
| Q |
378 |
ctgatatggatttacattgcccatcctgct |
407 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |
|
|
| T |
116610 |
ctgatatggatttacattgctcatcctgct |
116639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 116287 - 116333
Alignment:
| Q |
202 |
aatcaattctaccatttgattcatgtcttcttctgttaggaatccac |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
116287 |
aatcaattctaccatttgattcatgtcttcttccgttagaaatccac |
116333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 248 - 280
Target Start/End: Original strand, 116423 - 116455
Alignment:
| Q |
248 |
cagctgaggtcattggtgtatcgagttcctaca |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
116423 |
cagctgaggtcattggtgtatcgagttcctaca |
116455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University