View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_2D_high_45 (Length: 307)
Name: NF1623_2D_high_45
Description: NF1623_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_2D_high_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 7e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 21510049 - 21510181
Alignment:
| Q |
1 |
tacatgttagacatcagacacgtcttcgaaaagaagtgtctgtgataaaaacacaataatgttgtatggaagtgaaccctttctcatagaaaagtgaata |
100 |
Q |
| |
|
||||||||||||| | ||||||||||||| |||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21510049 |
tacatgttagacaccggacacgtcttcgataagaagtgtctg--ataaaaacacaataatgttatatgaaagtgaaccctttctcatagaaaagtgaata |
21510146 |
T |
 |
| Q |
101 |
accaacaaaaaactgttcttattcaattcaactac |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
21510147 |
accaacaaaaaactgttcttattcaattcaactac |
21510181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 200 - 285
Target Start/End: Original strand, 21510246 - 21510331
Alignment:
| Q |
200 |
ggggtaatacataccctatcaacaaaacgagcgtcaaaatcagcagaaagagaaccgttgagttcgcattgaatcttgacatgttt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21510246 |
ggggtaatacataccctatcaacaaaacgagcgtcaaaatcagcagaaagagaaccattgagttcgcattgaatcttgacatgttt |
21510331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University